Jump to content

equals()


ssofia
 Share

Recommended Posts

boolean enc = false;

        int i = 0;

        while(!enc && i <= dna.length()-padrao.length())

            {

            if(dna.substring(i, i+padrao.length()).equals(padrao))

                enc = true;

            else i++;

            }

        if (enc) System.out.println("Encontrado na posição:" + i);

        else System.out.println("Nao encontrado:");

       

Ola pessoal....Alguem me pode ajudar a ler este codigo????eu sei que o metodo equals() compara e retorna valores booleanos.....

Mas precisava so de uma pequenina ajudinha....Para perceber exactamente o que esta no codigo....

Obrigado

Link to comment
Share on other sites

O teu pedaço de código verifica se, por exemplo, "CCAC"(padrao) existe em "GATCCACCCATCTCGGTCTCCCAAAGT" (dna). E como é que faz isso?

1. Declara-se que a primeira posicao de procura no adn é 0 (primeira caracter da string adn)

2. Vai ver se os caracteres de 0 a 3 do dna ("GATC") são iguais ao padrão. Não são. Incremementa posição de procura.

3. Vai ver se os caracteres de 1 a 4 do dna ("ATCC") são iguais ao padrão. Não são. Incremementa posição de procura.

4. Vai ver se os caracteres de 2 a 5 do dna ("TCCA") são iguais ao padrão. Não são. Incremementa posição de procura.

5. Vai ver se os caracteres de 3 a 6 do dna ("CCAC") são iguais ao padrão. São iguais! Encontrado na posição 3!

Link to comment
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now
 Share

×
×
  • Create New...

Important Information

By using this site you accept our Terms of Use and Privacy Policy. We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.